As a demonstration of the stupidity in the media,
In todays Motley Fool UK, Christopher Spink published an article called "Cracking the Code". He comes to the moronic conclusion that after yesterday's remarks by Blair and Clinton, that any company in any way associated with genetic manipulation (in vivo or in vitro) will be forced to share all their intellectual property for free. He seems completely oblivious to the intention of Clinton's message yesterday which is that the raw sequencing data (i.e CGCCCGGGTAATCGGACTGCC etc.) should be made available to everyone. I have news for Mr. Spink, IT ALREADY IS. If Mr. Spink is reading this message perhaps he should go to ncbi.nlm.nih.gov and search for genes linked with stupidity. It's a free service just for him! Mr. Spink has the audacity to use CAT and OGS as examples of companies which will have to give up their intellectual property so that the "scientists involved might have to return to their academic roots and shun any profit from their research". He suggests that CAT's Ig phage display library will become a free service. Amazing! He clearly has no clue what an Ig phage display library is and I'm not going to be the one to explain it to him. Perhaps he'd like to go our CAT thread to learn a little about the company before he starts mouthing off. CAT makes therapeutics with their technology, they do not sell CGCTATGC! Just for today I'd like to add a few nucleotides for Mr. Spink which I'd like to annotate with the letters F and K. We'll just throw in a cytosine and a uracil in between and he should get the message. Furthermore, Clinton and Blair made it very clear that protein data should be protected. Maybe Mr. Spink has no clue what OGS does but you'd think that it might occur to him that there is a relationship between PROTEINS and PROTEOMICS. What an idiot this guy is. As I wrote yesterday, this entire scare, as unfounded as it is, should only serve to strengthen the positions of the drug discovery companies which support the genomics sector. The elite group of drug discovery companies which have niche technologies such as human Ig engineering capacities and high throughput proteomics abilities should actually be holding the genomics sector up under these circumstances. They certainly don't deserve a collateral whipping. One last message for Mr. Spink: Try reading some scientific literature. If you can't understand it, don't write about it!
Here's the article (At the end there is a link for feedback):
Fool's Eye View
[ March 15, 2000 ]
Cracking the code
By Christopher Spink (TMFEagle)
fool.co.uk
10:00am: Great Titchfield Street, London -- Last night the Nasdaq Composite Index fell by 200 points, or just over 4%, to 4706. This happened amid concerns that biotech companies would not profit as much as previously thought from the project to decode the human genome. President Clinton has agreed with Tony Blair that scientists should have free access to this information, rather than paying the companies which have helped to carry out the research.
Admittedly Nasdaq stocks have still soared by over 15% this year so far. This announcement was merely the trigger, which sparked this slight sell-off. However, the shock waves have been felt this morning amongst UK biotech companies also closely involved in genetic research, such as Oxford Glycosciences (LSE: OGS) and Cambridge Antibody Technologies (LSE: CAT) . Both of these companies have seen their stocks race ahead this year.
Since the start of January Oxford has gone up 317% and Cambridge has jumped 292%. Over the past twelve months the gains have been even more impressive, with Oxford sporting a 593% jump and Cambridge boasting a 920% leap. This gives Oxford a market value of œ797m and Cambridge one of œ688m. Cambridge has compiled a database of all known human antibodies. Investors are obviously worried that scientists could claim access to this knowledge for free as well.
Neither Oxford nor Cambridge has yet made a profit. And with sales for both concerns, in the form of milestone payments from larger pharmaceutical companies, hovering around the œ1m mark, it seems unlikely a profit will transpire for many years to come.
And yesterday PPL Therapeutics (LSE: PTH) announced that it would take at least four years before any clinical trials could even begin for transplanting organs from its cloned pigs into humans. This reinforced the immense patience investors in such speculative concerns must have.
Added to this patience, investors will now also have to shake off worries that companies that conduct such research may have to make their findings freely available. It was not surprising then that shares in both Oxford and Cambridge have shed around a fifth of their value this morning. The scientists involved might have to return to their academic roots and shun any profit from their research. Whether this noble ideal is incentive alone remains to be seen.
On a wider scale large pharmaceutical companies, such as Glaxo Wellcome (LSE: GLXO) and AstraZeneca (LSE: AZN) , should benefit. Their research costs should fall with access to the latest information freed up. Perhaps this is why Glaxo has risen 26p, or 1.5%, to 1711p so far this morning.
This sell-off also highlights the differences between biotechs and so-called Internet companies. These two groups are often spoken of in the same breath, probably because they tend to be loss-making and focussing on future revenue and profit.
The difference is that biotechs normally concentrate on only one or two projects, which may come to fruition sometime in the future. Many Internet-based companies however are growing all the time as their products are increasingly used. Revenues subsequently rise and profits may not be as far off as in the biotech world. Perhaps Lastminute.com (LSE: LMC) then looks a safer bet in this light?
Please post all feedback on this feature to the Fool's Eye View message board.
|
