Is there a 3 post quota system at RBull now LOL click on my name there and tell me how many postI did today LOL: This will not post there :
NOT GMED related except SEARCH CRITERIA PHRASE: TOP part Library"" without HAVING TO IMM....""
Bottom last sent phrase "BAM": Chucka CRITERIA: ""..ttl/gene or ttl/dna and spec/library andnot (rna"" OTHERS but read impact LIBRARY without having to applies to any LIBRARY GENE BASED STUDY IMHO:
"..//..
That technique consists of inserting a repertoire of genes for variable antibody regions in association with a bacteriophage gene into a vector under conditions which enable expression of the gene in the form of a fusion protein at the phage surface, exposing the variable regions of the light and heavy chains bonded by their disulphide bridges in the manner of a Fab antibody fragment, and directly selecting the phages by a rapid separation method using the immobilised specific antigen, for example by immunoaffinity chromatography. After elution, the selected phages can infect a bacterium and be used for direct production or to repeat the selection cycles. That method is particularly powerful as in theory very large libraries can be created and screening of the library is very fine, efficient and rapid. One phage which is particularly suitable for that method is the filamentous phage fd, into which the fragment coding for one of the heavy and light chains of the antibody can be fused with the gene for the minor surface protein and into which the fragment coding for the other chain can be inserted, so that after infecting the bacteria with the phage, a population of phages is obtained carrying a fusion protein at their surface with the heavy and light chains in a configuration which is capable of recognizing the antigen, and is thus suitable for screening.
In addition to its simplicity, the advantages of that technique are enormous. Combined with prior amplification of the antibody gene library, a phage with a specific antibody fragment can be selected in a very large population of phages, in the order of 10.sup.7, which means that human antibody genes can be researched without being obliged to immunise the donor first.
Phages which randomly combine a light chain and a heavy chain can be obtained by cleaving followed by re-ligation or from two separate libraries of light chain genes and heavy chain genes.
However, the number of different clones which can be obtained is limited by the selection yield and by the degree of efficiency of the bacterial transformation.
One way of increasing the number of successful associations combining the light chains of a first library with the heavy chains of a second library has been described by P. WATERHOUSE et al., Nucleic Acids Research, 1993, vol. 21, No. 9, 2265-2266. Up to 10.sup.12 clones can be obtained using a system of specific recombination of loxP sites sensitive to the action of Cre recombinase. However, the combination is reversible. Further, there is no control of the action of the recombinase and the recombinant vectors have no selective advantage over other vectors.
Considering the yield of the recombinant phage selection step which in reality retains only a fraction of the phages of interest, it would be desirable to obtain recombinant vector yields which were as high as possible with as few as possible non-recombinant vectors.
In a previous application (WO 95/21914 filed 2.sup.nd February 1995 with French priority FR 94 01519 of 10.sup.th February 1994), the inventors of the present invention described a method for the production of multicombinatorial libraries, in particular in the form of phages or phagemids, from two repertoires of genes, one for light chains and the other for heavy chains, to obtain a high number of clones.
That system has improved non-reversibility and selectivity properties since a new selection marker appears after recombination.
The non-reversibility properties are due to the absence of excision means in the vectors and in the host strain. The examples illustrating that application are thus characterised by the absence of the Xis excision protein in the vectors and in the Xis strain.
Further, the stable character of the joining sequences from recombination of specific recombination sites contributes to the non-reversibility of the system.
The present invention aims to improve that method further, in particular to increase its yield, the ease of implementing it and the diversity of the generated clones.
To this end, after two recombination events, the invention exchanges sequences between the two vectors. This exchange gives rise to two recombinant vectors, one with the two transcription units for the heavy and light chains but which is smaller in size than that of a vector which would result from fusion between the two starting vectors. As the final vector is smaller, its replication and packaging are more efficient and production is also improved, thus increasing the final number of clones.
The invention can also considerably broaden the choice of strains which can be used as host cells, in that it is no longer necessary for the strain used to possess the gene for integrase in its genome, that gene currently being carried by one of the two starting vectors and being found in the final vector.
This means that one is no longer restricted to strains with the gene for integrase integrated into their genome and any highly infectious strain producing phages can be selected (TG1, 71-18 or NM522).
Strains 71-18 (Stratagene; Yanisch-Perron, C. et al., (1985) Gene 33, 103-109) and NM522 (New England Biolabs; Woodcock, D. L., et al., (1989) Nucl. Acids Res. 17, 1563-1575) have proved to be particularly good phage producers. They can multiply the number of phages produced by a factor of 10 to 50 with respect to the D1210HP E. coli strain produced by Stratagene.
The invention provides a method for the production of multicombinatorial libraries in which, starting from a first repertoire of genes coding for a population of one of two types of polypeptides, which can covalently or otherwise combine, in particular variable regions of one of the antibody light or antibody heavy chains, and at least one gene coding for the other type of polypeptide, in particular a variable region of the other type, an antibody chain or preferably a second repertoire of genes coding for a population of said other type, introducing the genes of said first repertoire into a first starting vector to form a population of final vectors carrying different genes of said first repertoire, and introducing said gene of said other type or genes of said second repertoire into a second starting vector, and recombining said first and second starting vectors under conditions under which one of the vectors will contain, after recombination, one gene for one of the two types and one gene for the other type, and expressing the two genes in the form of associated polypeptides which can appear on the external surface of the product of said vector and remain there, being combined together multimerically or so as to simulate a multimer, characterised in that said first and second vectors include means for exchanging one portion of each by irreversible recombination(s) to generate recombinant final vectors after the recombination(s), one containing a gene of one of the two types and a gene of the other type.
Advantageously, the method of the invention is further characterised in that the starting vectors respectively contain two specific recombination sites of one or two specific recombination systems, in particular attB sites of E. coli and attP sites of lambda phage, arranged so as to allow two recombination events under the influence of an associated recombinase or integrase to form two sequences of stable attachment such as attL and attR in each of the final vectors resulting from recombination.
Preferably, the two recombination sites in each of the starting vectors are in the opposite orientation.
In an advantageous variation, the starting vectors respectively contain two attp lambda phage sites and two attB E. coli sites.
Preferably, one of the two starting vectors further comprises a sequence coding for a recombinase or an integrase. This advantageous variation means that any strain which is highly infectious and produces a phage, for example TG1, 71-18 or NM522, can be used without having to be limited to strains containing the gene for one or the other of these enzymes in their genome. Strains NM522 and 71-18 have proved to be particularly important in this context. Preferably, the enzyme used to control the recombination step between the starting vectors is an inducible recombinase, in particular a thermo-inducible recombinase.
Advantageously, in the method of the invention, the final recombinant vector obtained from the starting vectors which contains the genes to be expressed is arranged so as to have a selection marker which is initially non-functional and which is rendered functional by recombination. This marker is a gene for antibiotic resistance, for example, in particular a gene from the group formed by genes resistant to tetracyclines, gentamycin, kanamycin and chloramphenicol, with its promoter.
This selection marker preferably comprises a promoter for the gene, the promoter initially being inserted in one of the starting vectors and the marker gene in the other. The selection gene and its promoter can be separated, for example by an antiterminating sequence, in particular the NutL sequence. The starting vectors also contain at least one phage origin of replication or plasmid origin of replication, the origins being arranged so that the final recombinant vectors each contain only one phage and/or plasmid origin of replication.
In the method of the invention, one of the two genes to be expressed is fused to a sequence coding for all or part of a polypeptide of the phage capsid. This sequence corresponds, for example, to the gene coding for protein III of the lambda phage. The gene to be expressed and the sequence to which it is fused are advantageously located in one of the starting vectors so as to be present in the recombinant phagemid product containing the two genes to be expressed.
The invention also provides vectors obtained or obtainable using the above method, in particular plasmid or phagemid vectors which are characterised by the presence of a sequence coding for one of two types of polypeptides which can combine together, in particular a variable portion of the antibody light chain, and a sequence coding for the other of said two types, in particular a variable portion of the antibody heavy chain, said sequences being accompanied, in suitable frames, by elements allowing their expression in a host, said sequences being separated by stable attachment sequences, in particular attR and attL.
These vectors, in particular plasmid type vectors, preferably comprise a functional sequence coding for a recombinase or integrase, and it is particularly advantageous if they also comprise stable attachment sequences separated by a spacer.
The invention also provides multicombinatorial libraries of vectors formed by the vectors of the invention and combining, in a random fashion, a sequence coding for one of two types of polypeptides which can associate together, in particular a variable portion of the antibody light chain and a sequence coding for the other of said two types, in particular a variable portion of the antibody heavy chain.
Finally, the invention provides antibodies or antibody Fab type portions obtainable after selecting libraries of vectors in accordance with the invention using selection markers, then screening to select the clones expressing associations of the antibody light and heavy chains with the desired affinities for set antigens, then expressing the screened clones in an expression system, and finally extracting and/or purifying the antibodies or antibody Fab type portions produced in the expression system. Selection and screening techniques are described, for example, in Parmley SF et al., Gene 73 (1988), 305-318. Extraction and purification techniques are described, for example, in Neu H. C. et al., (1965), J. Biol. Chem. 240, 3685-3692.
An example will now be given of the construction of a recombinant vector of the invention combining the variable portions of the light chain and the heavy chain of an HIV anti-gp160 clone, a vector which has proved to be capable of expressing genes of said variable light and heavy portions and displaying their expression products on its surface or, in a variation, secreting them in the form of a heavy chain--light chain combination recognizing the gp160 antigen.
The same technique can be used to produce multicombinatorial constructions combining the genes of a repertoire of variable light chain portions with a gene for a variable heavy chain portion or a repertoire of variable heavy chain portions with a gene for the variable light chain portion or two repertoires of variable heavy and light portions.
FIGURES
FIG. 1 is a schematic diagram of plasmid pM858 with a transcription unit for the variable light chain regions fused with the gene III.
FIG. 2 is a schematic diagram of phagemid pM867 with a transcription unit for the variable heavy chain regions.
FIG. 3A-3B is a schematic diagram of the recombinant vectors obtained after sequence exchange between plasmid pM858 and phagemid pM867.
FIG. 3A is the multicombinatorial 7.2 kb phagemid with two transcription units for the heavy and light chains.
FIG. 3B is the 6.5 kb recombinant plasmid containing the integrase gene.
DESCRIPTION OF VECTORS
Reference should be made to International patent application WO 95/21914, hereby incorporated by reference, for details of the molecular biological techniques used in constructing the vectors.
Plasmid pM858 (7.2 kb): Plasmid with a "high-copy-number" ColE1 origin of replication, a transcription unit for the variable regions of the light chains fused with gene III (lacZ promoter--PelB signal sequence-VH gene III), gene N followed by the gene coding for the gentamycin selection marker, the ampicillin selection marker and two attP recombination sequences in the opposite orientation separated by a spacer which must be at least 2 kb.
Phagemid pM867 (6.5 kb): Vector with a "low-copy-number" origin of replication p15A, lambda phage integrase and the heat sensitive repressor cI857, a kanamycin selection marker, and two attB recombination sequences in the opposite orientation separated by the following sequences: one transcription unit for the variable heavy chain regions (lacZ-pelB-VH), the origin of replication for phage F1, the tryptophane promoter Trp followed by the antiterminator NutL in the same orientation.
After recombination (2 recombination events), the sequences separating the recombination sequences had been exchanged between the starting phagemid and the plasmid. A recombinant phagemid was obtained with two attR sequences in the opposite orientation separated by elements from the starting plasmid, namely the unit for transcription of the variable heavy chain regions, the F1 origin, the Trp promoter followed by NutL. In the recombinant phagemid containing two transcription units for the heavy and light chains, a transcription unit for a new selection marker, in this case gentamycin (Trp promoter-NuTL-N-gentamycin) was also created.
The other properties of this system (non-reversibility, new selection marker after recombination) were identical to that of the prior art system described in WO 95/21914.
I--Description of the various steps of constructing the two starting vectors.
I. Creation of a plasmid with an origin of replication ColE1, an ampicillin resistance gene, a gentamycin resistance gene (without its promoter), the N protein gene, the cassette for cloning the light chains and 2 attP recombination sequences framing a spacer of about 2 kb.
This vector acted as a starting point for insertion of the library of light chains (variable regions).
1. Insertion of first recombination sequence attP (271 bp) after PCR amplification on .lambda. phage (bases 27571 to 27820), between the EcoRI and KpnI sites of pUC18 plasmid (2686 bp) (controlled orientation).
Plasmid pM852 was obtained (2957 bp).
AttP Eco-Nhe+ primer: (SEQ ID NO.:1)5' GGAATTCCGGCTAGCCGCGCTAATGCTCTGTTACAG3'EcoRI SphIAttP Kpn- primer: (SEQ ID NO.:2)5' GGGGTACCCCATCAAATAATGATTTTATTT 3'KpnI
2. Insertion of gentamycin resistance gene (gene aacC1) coupled to the second recombination sequence attP.
The attP sequence was amplified by PCR of the .lambda. phage from bases 27571 to 27820 using the following primers:
AttP Xba-Nhe+ primer: (SEQ ID NO.:3)5' GCTCTAGAGGGCTAGCGCTAATGCTCTCTGTTACAG 3'XbaI NheIAttP Bam- primer: (SEQ ID NO.:4)5' CGGGATCCCATCAAATAATGATTTTATTT 3'BamHI
164.195.100.11
Chucka No I didn't find any referance yet
PS TRYS
164.195.100.11
PAT. NO. Title
1 6,340,579 Gene encoding an alpha-hydroxy-gamma-carboxymuconic acid-epsilon-semialdehyde dehydrogenase
2 6,340,566 Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches
3 6,339,183 Transgenic mammals expressing heterologous DNA in urothelium and isolation of biologically active molecules from urine
4 6,337,201 .beta.-fructofuranosidase and its gene, method of isolating .beta.-fructofuranosidase gene, system for producing .beta.-fructofuranosidase, and .beta.-fructofuranosidase variant
5 6,335,008 Hybrid genes incorporating a DNA fragment containing at least one gene encoding an insecticidal protein and a gene encoding a glutamine synthase inhibitor, plasmids, transformed cyanobacteria expressing such proteins and method for use as biocontrol agent
6 6,333,183 Dideoxynucleotide-triphosphate utilization by the hyper-thermophilic DNA polymerase from the archaeon Pyrococcus furiosus
7 6,331,428 Hexulose phosphate isomerase gene
8 6,331,397 Method for producing long DNA const
..""
Chucka CRITERIA: ""..ttl/gene or ttl/dna and spec/library andnot (rna""
and PS earlier TRY it goes this far and NO SKOW UP:
Successful Posting!
Your post (Msg. 1390) is now on the GMED board.
• View the live post
• Return to the GMED message list
You posted:
By: Chucka
22 Jan 2002 7:18 PM EST Msg. 1390 of 1390
RE QUOTE, I never saw: an app cause I was in the ISSUED section will do tomorrow: ..//.."already filed initial patent applications with the United States Patent and Trademark Office that substantiate improved patient outcomes in pilot trials. ../.."" Chucka Easy Patent Search at PTO- DAH wrong section selection criteria ! DAH DAH DA---H chucka.i8.com htrtp://www.chucka.50megs.com
I changed .i8.com to eyeate LOL I changed DAH to D---AH( I rechanged it BACK for SI LOL)
Chucka PS a 7 POSTings POSTER ONLY today LOL:
Board Subject Date
BHMNF MUST SEE: NANO in gold -LOL- NOVELL is FICTION in 22 Jan 2002
7:12 PM EST
VISN Aye See now: LOL; 22 Jan 2002
4:07 PM EST
ETEN Well, do you like VISN? Don;t know: LOL a miss pos 22 Jan 2002
4:01 PM EST
VISN OT: Sorry, wrong board, meant to put in the refere 22 Jan 2002
3:57 PM EST
VISN I just looked at the Chart of VISN and then TYC, I 22 Jan 2002
1:53 PM EST
GMED Wait a min look at GNSL- a 6 fold differance in Ma 22 Jan 2002
12:37 PM EST
BHMNF PP notice I actually made money: 1999, as a PP inv 22 Jan 2002
9:16 AM EST
ETEN Thanks, |
