SI
SI
discoversearch

We've detected that you're using an ad content blocking browser plug-in or feature. Ads provide a critical source of revenue to the continued operation of Silicon Investor.  We ask that you disable ad blocking while on Silicon Investor in the best interests of our community.  If you are not using an ad blocker but are still receiving this message, make sure your browser's tracking protection is set to the 'standard' level.
Pastimes : SARS - what next?

 Public ReplyPrvt ReplyMark as Last ReadFilePrevious 10Next 10PreviousNext  
To: Maurice Winn who wrote (741)9/13/2003 10:24:49 AM
From: Henry Niman  Read Replies (1) of 1070
 
The latest I have heard on Surrey outbreak is that Winnipeg was having problems replicating their initial serology data. They will be testing later collections from some of the patients associated with stronger positives.

The sequence data can't be confirmed directly because samples have been used up, so confirmation of SARS CoV is now dependent on the follow-up serology work. Winnipeg did confirm the presence of OC43 sequences.

The ratio of 12 Tor2 sequences to 1 HKU39849 sequences is somewhat similar to the ratio of the M gene polymorphisms in the original Tor2 isolate, which does raise the issue of contamination.

Of interest, the original Tor2 clones also have several clones with a small region of OC43 homology in the N gene:

Query= SARS12.B21_B08_-_073.ab1 CHROMAT_FILE:
SARS12.B21_B08_-_073.ab1 PHD_FILE: SARS12.B21_B08_-_073.ab1.phd.1
CHEM: term DYE: big TIME: Sat Apr 12 12:11:01 2003 TEMPLATE: SARS12B08
DIRECTION: fwd
1_3500 250 caccgatattgacggagtctac 271
30061510 29813 .................... 29832
17529670 29825 .................... 29844
18033971 29809 ......c............... 29830
15077808 29809 ......c............... 29830
210700 490 ......c............. 509
6706935 8320 ......c............. 8339
6706924 8320 ......c............. 8339
6706913 8327 ......c............. 8346
34398245 2107 ......c............. 2126
Report TOU ViolationShare This Post
 Public ReplyPrvt ReplyMark as Last ReadFilePrevious 10Next 10PreviousNext