Silicon Investor (SI) -- The First Internet Community

STOCKTALK

We've detected that you're using an ad content blocking browser plug-in or feature. Ads provide a critical source of revenue to the continued operation of Silicon Investor. We ask that you disable ad blocking while on Silicon Investor in the best interests of our community. If you are not using an ad blocker but are still receiving this message, make sure your browser's tracking protection is set to the 'standard' level.

Pastimes : SARS - what next? -- Ignore unavailable to you. Want to Upgrade?

To: Maurice Winn who wrote (741)	9/12/2003 5:25:03 PM
From: Ilaine	Read Replies (1) \| Respond to of 1070

Dubya does look sort of like a chimp, but a nice one. Thank for the link, I enjoyed the photo of him with his infant daughters best.

To: Maurice Winn who wrote (741)	9/12/2003 7:30:38 PM
From: Henry Niman	Respond to of 1070

>>They don't want the plebs to panic. << Yes, that is certainly what it looks like. Meanwhile the virus continues to silently spread as WHO covers its eyes. Quite a commentary.

To: Maurice Winn who wrote (741)	9/13/2003 10:24:49 AM
From: Henry Niman	Read Replies (1) \| Respond to of 1070

The latest I have heard on Surrey outbreak is that Winnipeg was having problems replicating their initial serology data. They will be testing later collections from some of the patients associated with stronger positives. The sequence data can't be confirmed directly because samples have been used up, so confirmation of SARS CoV is now dependent on the follow-up serology work. Winnipeg did confirm the presence of OC43 sequences. The ratio of 12 Tor2 sequences to 1 HKU39849 sequences is somewhat similar to the ratio of the M gene polymorphisms in the original Tor2 isolate, which does raise the issue of contamination. Of interest, the original Tor2 clones also have several clones with a small region of OC43 homology in the N gene: Query= SARS12.B21_B08_-_073.ab1 CHROMAT_FILE: SARS12.B21_B08_-_073.ab1 PHD_FILE: SARS12.B21_B08_-_073.ab1.phd.1 CHEM: term DYE: big TIME: Sat Apr 12 12:11:01 2003 TEMPLATE: SARS12B08 DIRECTION: fwd 1_3500 250 caccgatattgacggagtctac 271 30061510 29813 .................... 29832 17529670 29825 .................... 29844 18033971 29809 ......c............... 29830 15077808 29809 ......c............... 29830 210700 490 ......c............. 509 6706935 8320 ......c............. 8339 6706924 8320 ......c............. 8339 6706913 8327 ......c............. 8346 34398245 2107 ......c............. 2126